Review





Similar Products

86
Servicebio Inc universal reverse pcr primer
Universal Reverse Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pmc13145395-9-2-7?v=Servicebio+Inc
Average 86 stars, based on 1 article reviews
universal reverse pcr primer - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Eurofins htrac hdr genomic reverse primer targeting rha
Htrac Hdr Genomic Reverse Primer Targeting Rha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pmc13265900-95-0-9?v=Eurofins
Average 86 stars, based on 1 article reviews
htrac hdr genomic reverse primer targeting rha - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech reverse primers
Reverse Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pm42276401-117-20-24?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
reverse primers - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Eurofins reverse primers
Reverse Primers, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pm42268715-402-22-27?v=Eurofins
Average 86 stars, based on 1 article reviews
reverse primers - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

94
OriGene gaatgccaccttcatccgagaag reverse
Gaatgccaccttcatccgagaag Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pm42234557-282-119-122?v=OriGene
Average 94 stars, based on 1 article reviews
gaatgccaccttcatccgagaag reverse - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
OriGene gcgacatactcaagcaggagca reverse
Gcgacatactcaagcaggagca Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pm42234557-282-130-133?v=OriGene
Average 94 stars, based on 1 article reviews
gcgacatactcaagcaggagca reverse - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
OriGene tcgcctccaactcaagctggtt reverse
Tcgcctccaactcaagctggtt Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pm42234557-282-97-100?v=OriGene
Average 94 stars, based on 1 article reviews
tcgcctccaactcaagctggtt reverse - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

99
tiangen biotech co reverse primer
Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pmc13019757-148-71-77?v=tiangen+biotech+co
Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

86
Eurofins n a htrac hdr genomic reverse primer targeting rha
N A Htrac Hdr Genomic Reverse Primer Targeting Rha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/10__1016_slash_j__isci__2026__116175-216-48-57?v=Eurofins
Average 86 stars, based on 1 article reviews
n a htrac hdr genomic reverse primer targeting rha - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

99
tiangen biotech co primer
Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pmc13010918-87-22-17?v=tiangen+biotech+co
Average 99 stars, based on 1 article reviews
primer - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

Image Search Results